Knowledgebase
ISEM plateforme de calcul > [aide] ISEM plateforme de calcul > Knowledgebase

Problème BlasDB

Solution

JY SIRE a envoyé ce message :

>>Je n'arrive plus à blaster mes séquences sur
>>mes bases de données "dipneuste et caiman" en
>>utilisant blastDB de la plateforme.
>>
>>J'accède bien à l'outil mais à chaque fois la
>>réponse est "Standard error file". Peut-être
>>que je m'y prends mal. Peux-tu me dire si la
>>démarche que je suis est la bonne?
>>
>>j'interroge en copiant dans la fenêtre la
>>séquence recherchée en format fasta:
>>
Au fait, après beaucoup de débogage, le problème vient vraiment de la séquence query !!!

Il faut absolument respecter le format fasta pour cette séquence, exemple:
>test1
ATTAGATGATCATGTCGTACGATGGGATAGCAGT

L'identifiant doit être présent, et de préférence la séquence doit être sur une seule ligne !

Il faut éviter également les copier-coller depuis word !

Article details
Article ID: 26
Category: Plateforme Web
Date added: 2013-04-03 06:38:20
Views: 174

 
« Go back

 
Powered by Help Desk Software HESK, in partnership with SysAid Technologies